Gene-drug interactions (data source: DGIdb)
Gene Name Entrez ID Drug Name Chembl ID Interaction Types Sources publications
SLC6A3 6531 BUPROPION CHEMBL894 inhibitor TdgClinicalTrial, GuideToPharmacologyInteractions, TEND
SLC6A3 6531 DEXTROAMPHETAMINE CHEMBL612 inhibitor TdgClinicalTrial, GuideToPharmacologyInteractions, ChemblInteractions, TEND
SLC6A3 6531 LEVOMILNACIPRAN CHEMBL99946 inhibitor GuideToPharmacologyInteractions
SLC6A3 6531 METHYLPHENIDATE CHEMBL796 inhibitor, blocker TdgClinicalTrial, GuideToPharmacologyInteractions, ChemblInteractions, NCI, TEND, TTD 12699766, 15572278, 15827573
SLC6A3 6531 FENCAMFAMIN CHEMBL7010 inhibitor TEND, TdgClinicalTrial, DrugBank 16478825, 6136281
SLC6A3 6531 PARA-METHOXYAMPHETAMINE CHEMBL278663 inhibitor DrugBank 17209801, 1982265, 11041537, 11861820
SLC6A3 6531 MIANSERIN CHEMBL6437 binder DrugBank 9537821
SLC6A3 6531 NICOTINE CHEMBL3 NCI 15229055
SLC6A3 6531 LIAFENSINE CHEMBL2364614 inhibitor ChemblInteractions
SLC6A3 6531 AMPHETAMINE SULFATE CHEMBL501 ChemblInteractions
SLC6A3 6531 BUPROPION HYDROBROMIDE CHEMBL1201735 inhibitor ChemblInteractions
SLC6A3 6531 AMPHETAMINE ADIPATE CHEMBL1200387 ChemblInteractions
SLC6A3 6531 CHEMBL432878 CHEMBL432878 blocker TTD
SLC6A3 6531 SERTRALINE CHEMBL809 TdgClinicalTrial
SLC6A3 6531 DIETHYLPROPION CHEMBL1194666 TdgClinicalTrial, TEND
SLC6A3 6531 DEXTROAMPHETAMINE SULFATE CHEMBL3544971 ChemblInteractions
SLC6A3 6531 DEXTROAMPHETAMINE SACCHARATE CHEMBL1200992 ChemblInteractions
SLC6A3 6531 CHEMBL543876 CHEMBL543876 blocker TTD
SLC6A3 6531 CHEMBL528995 CHEMBL528995 TdgClinicalTrial
SLC6A3 6531 MIRTAZAPINE CHEMBL654 binder DrugBank 15771415, 9537821
SLC6A3 6531 LOXAPINE CHEMBL831 binder DrugBank
SLC6A3 6531 PROCAINE CHEMBL569 inhibitor DrugBank 16956595, 10685879, 16206183
SLC6A3 6531 MODAFINIL CHEMBL1373 inhibitor TdgClinicalTrial, ChemblInteractions, DrugBank 17477916, 11222668, 15537337, 14658934, 16885432
SLC6A3 6531 COCAINE CHEMBL370805 inhibitor TdgClinicalTrial, TEND, DrugBank 9537821, 12672245, 15351386, 10420171, 8797532
SLC6A3 6531 CLOMIPRAMINE CHEMBL415 inhibitor GuideToPharmacologyInteractions
SLC6A3 6531 DESVENLAFAXINE CHEMBL1118 inhibitor GuideToPharmacologyInteractions
SLC6A3 6531 DEXMETHYLPHENIDATE CHEMBL827 inhibitor TdgClinicalTrial, GuideToPharmacologyInteractions
SLC6A3 6531 CHEMBL608538 CHEMBL608538 inhibitor GuideToPharmacologyInteractions
SLC6A3 6531 NOMIFENSINE CHEMBL273575 inhibitor GuideToPharmacologyInteractions, DrugBank 9537821
SLC6A3 6531 PHENELZINE CHEMBL1089 inhibitor GuideToPharmacologyInteractions
SLC6A3 6531 METHYLENEDIOXYMETHAMPHETAMINE CHEMBL43048 negative modulator DrugBank 17209801, 1982265, 11861820
SLC6A3 6531 AMITIFADINE CHEMBL592374 TdgClinicalTrial
SLC6A3 6531 DASOTRALINE CHEMBL3301595 inhibitor ChemblInteractions
SLC6A3 6531 DEXTROAMPHETAMINE ADIPATE CHEMBL1200782 ChemblInteractions
SLC6A3 6531 METHYLPHENIDATE HYDROCHLORIDE CHEMBL1722 inhibitor ChemblInteractions
SLC6A3 6531 CHEMBL488638 CHEMBL488638 TdgClinicalTrial
SLC6A3 6531 LISDEXAMFETAMINE CHEMBL1201222 TdgClinicalTrial, TEND
SLC6A3 6531 TEDATIOXETINE CHEMBL2104986 inhibitor TdgClinicalTrial, ChemblInteractions
SLC6A3 6531 PHENDIMETRAZINE TARTRATE CHEMBL1898523 inhibitor ChemblInteractions
SLC6A3 6531 SIBUTRAMINE HYDROCHLORIDE CHEMBL1200765 inhibitor ChemblInteractions
SLC6A3 6531 DEXMETHYLPHENIDATE HYDROCHLORIDE CHEMBL904 inhibitor ChemblInteractions
SLC6A3 6531 AMPHETAMINE CHEMBL405 negative modulator TdgClinicalTrial, ChemblInteractions, NCI, TEND, DrugBank 15728379, 15764732, 15950014, 15602501, 15661631, 15795321, 12624535
SLC6A3 6531 AMOXAPINE CHEMBL1113 binder DrugBank
SLC6A3 6531 BENZPHETAMINE HYDROCHLORIDE CHEMBL3544906 inhibitor DrugBank 15728379, 15955613
SLC6A3 6531 SIBUTRAMINE CHEMBL1419 inhibitor TdgClinicalTrial, GuideToPharmacologyInteractions, DrugBank 10929704, 19475780, 10974319, 11152984, 15111248, 15382615
SLC6A3 6531 CHLORPHENIRAMINE POLISTIREX CHEMBL1201659 inhibitor DrugBank 9537821
SLC6A3 6531 CHEMBL2079586 CHEMBL2079586 inhibitor GuideToPharmacologyInteractions
SLC6A3 6531 CHEMBL126506 CHEMBL126506 negative modulator DrugBank 17209801, 15955613, 10773193
SLC6A3 6531 METHAMPHETAMINE CHEMBL1201201 negative modulator TdgClinicalTrial, DrugBank 15728379, 17209801, 15764732, 15950014, 15602501, 15661631, 19897077, 15795321
SLC6A3 6531 METHYL SALICYLATE CHEMBL108545 inhibitor DrugBank
SLC6A3 6531 PHENMETRAZINE HYDROCHLORIDE CHEMBL1200483 inhibitor ChemblInteractions
SLC6A3 6531 BUPROPION HYDROCHLORIDE CHEMBL1698 inhibitor ChemblInteractions
SLC6A3 6531 LISDEXAMFETAMINE DIMESYLATE CHEMBL1201178 TdgClinicalTrial, ChemblInteractions
SLC6A3 6531 METHAMPHETAMINE HYDROCHLORIDE CHEMBL1200952 inhibitor ChemblInteractions
SLC6A3 6531 MAZINDOL CHEMBL781 inhibitor GuideToPharmacologyInteractions, ChemblInteractions, DrugBank 10823899, 11719704, 12213055, 9537821, 10082805, 10980236, 12213053, 11248372
SLC6A3 6531 PHENMETRAZINE CHEMBL1201208 inhibitor TdgClinicalTrial, TEND, DrugBank 17017961, 17139284, 17016423, 12106802
SLC6A3 6531 DIPHENYLPYRALINE CHEMBL1492 inhibitor DrugBank 15627433
SLC6A3 6531 ATOMOXETINE CHEMBL641 inhibitor GuideToPharmacologyInteractions
SLC6A3 6531 TRIMIPRAMINE CHEMBL644 inhibitor GuideToPharmacologyInteractions
SLC6A3 6531 AMPHETAMINE ASPARTATE CHEMBL1200377 ChemblInteractions
SLC6A3 6531 DIETHYLPROPION HYDROCHLORIDE CHEMBL1693 inhibitor ChemblInteractions
SLC6A3 6531 PHENTERMINE CHEMBL1574 TdgClinicalTrial, TEND
SLC6A3 6531 PSEUDOEPHEDRINE CHEMBL1590 TdgClinicalTrial
SLC6A3 6531 BENZTROPINE CHEMBL1201203 TdgClinicalTrial, TEND
SLC6A3 6531 ACETYLCYSTEINE CHEMBL600 NCI 15542721
SLC6A3 6531 ARMODAFINIL CHEMBL1201192 antagonist, inhibitor TdgClinicalTrial, ChemblInteractions, DrugBank 22537794

Variant-drug associations (data source: PharmGKB)
Gene Name Variant Alleles Chemical Phenotype Category Significance Notes Sentence Publications Annotation ID
SLC6A3 rs2550956 G methylphenidate efficacy no Allele G is not associated with response to methylphenidate in children with Attention Deficit Disorder with Hyperactivity as compared to allele A. 16082688 1450374964
SLC6A3 rs2550948 CC + CT methylphenidate efficacy yes For the genetic component, in the CGI-S model, a dominant effect in SLC6A3 rs2550948 was found with a significant improvement in the symptoms. Clinical Global Impression-Severity (CGI-S) scale and the Children’s Global Assessment Scale (CGAS). Genotypes CC + CT are associated with increased response to methylphenidate in children with Attention Deficit Disorder with Hyperactivity as compared to genotype TT. 28871191 1450376539
SLC6A3 rs2652511 G methylphenidate efficacy no Clinical Global Impression-Severity (CGI-S) scale and the Children’s Global Assessment Scale (CGAS). Allele G is not associated with response to methylphenidate in children with Attention Deficit Disorder with Hyperactivity as compared to allele A. 28871191 1450376638
SLC6A3 rs460000 GG amphetamine "dosage","efficacy" no This association was not significant after correction for multiple testing. Association was with changes on the stimulation scale and on the euphoria scale. Genotype GG is associated with increased response to amphetamine in healthy individuals as compared to genotypes GT + TT. 20091113 981501538
SLC6A3 rs2975226 A clozapine "dosage","efficacy" yes This is reported as T being the allele associated with responsiveness. Reporting seems to be done with respect to the gene, which is on the negative chr. strand, so I am reporting A on the positive strand to be the associated one, but there is potential for confusion of alleles. Allele A is associated with increased response to clozapine in people with Schizophrenia as compared to allele T. 20580759 981502125
SLC6A3 rs2292023 A Selective serotonin reuptake inhibitors efficacy no Compares association with 3 genotypes and 2 alleles with response and found no association in either case. Allele A is not associated with response to Selective serotonin reuptake inhibitors in people with Depressive Disorder, Major as compared to allele C. 25642918 1447679448
SLC6A3 rs2550956 A Selective serotonin reuptake inhibitors efficacy no Reported as reverse strand C and T. Compares association with 3 genotypes and 2 alleles with response and found no association in either case. Allele A is not associated with response to Selective serotonin reuptake inhibitors in people with Depressive Disorder, Major as compared to allele G. 25642918 1447679454
SLC6A3 rs3863145 GG Selective serotonin reuptake inhibitors efficacy no **Please note that the authors reported this variant as being in the DRD4 gene. This variant is reported in dbSNP as being in the SLC6A3 gene**. Compares genotypes and alleles association with response. Alleles have been complemented to the plus chromosomal strand. Genotype GG is not associated with response to Selective serotonin reuptake inhibitors in people with Depressive Disorder, Major as compared to genotypes AA + AG. 25642918 1447679373
SLC6A3 rs6347 TT bupropion efficacy no Please note that alleles have been complemented to the positive strand. There was no significant difference in reduction of HAMD scores between the genotype groups. Genotype TT is not associated with decreased response to bupropion in people with Depressive Disorder, Major as compared to genotypes CC + CT. 22947179 1450814601
SLC6A3 rs2550948 C venlafaxine efficacy no Generalized anxiety disorder. No significant difference in the number of responders vs non-responders, or remitters vs non-remitters, was seen between any of the genotypes, when considering the Hamilton Anxiety scale (HAM-A) or the Clinical Global Impressions-Improvement scale (CGI-I). After 6 months of treatment, response defined as a HAM-A reduction of >= 50%, remission defined as HAM-A <= 7. On CGI-I scale, response defined as a CGI-I score of 1 and 2, remission defined as a CGI-I score of 1. Allele C is not associated with response to venlafaxine in people with Anxiety Disorders as compared to allele T. 24723432 1184747871
SLC6A3 rs3836790 ACATACACACTCAGACACACATACCATGCA/ACATACACACTCAGACACACATACCATGCA levodopa efficacy yes SLC6A3 rs3836790 genotype was significantly associated with the number of freezing of gait episodes, the number of steps and the completion time (with P-values of 0.004, 0.02 and 0.016, respectively). A multivariate analysis adjusted for age, gender, weight, disease duration and l-DOPA equivalent daily dose (or l-DOPA daily dose) revealed significant associations for the number of steps (P = 0.0005) the completion time (P = 0.001) and the number of freezing of gait episodes (P = 0.004). Genotype ACATACACACTCAGACACACATACCATGCA/ACATACACACTCAGACACACATACCATGCA is associated with increased response to levodopa in people with Parkinson Disease as compared to genotypes ACATACACACTCAGACACACATACCATGCA/del + del/del. 25805645 1444699815
SLC6A3 rs3836790 ACATACACACTCAGACACACATACCATGCA/ACATACACACTCAGACACACATACCATGCA levodopa efficacy yes In a multivariate analysis adjusted for the dose of l-DOPA, the SLC6A3 rs3836790 genotype was strongly correlated with the motor UPDRS score ON l-DOPA (P = 0.002) the number of steps ON l-DOPA (P = 0.0003), the completion time OFF l-DOPA (P = 0.027), the completion time ON l-DOPA (P = 0.0009) and the number of freezing of gait episodes ON l-DOPA (P = 0.017). Genotype ACATACACACTCAGACACACATACCATGCA/ACATACACACTCAGACACACATACCATGCA is associated with increased response to levodopa and methylphenidate in people with Parkinson Disease as compared to genotypes ACATACACACTCAGACACACATACCATGCA/del + del/del. 25805645 1444699877
SLC6A3 rs28363170 GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT venlafaxine efficacy no Generalized anxiety disorder. No significant difference in the number of responders vs non-responders, or remitters vs non-remitters, was seen between any of the genotypes, when considering the Hamilton Anxiety scale (HAM-A) or the Clinical Global Impressions-Improvement scale (CGI-I). After 6 months of treatment, response defined as a HAM-A reduction of >= 50%, remission defined as HAM-A <= 7. On CGI-I scale, response defined as a CGI-I score of 1 and 2, remission defined as a CGI-I score of 1. This rsID is a VNTR in the DAT 3'-UTR, individuals either had 9 ("del") or 10 ("GGG...") repeats at this position (genotypes were 10/10, 10/9 and 9/9). Allele GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT is not associated with response to venlafaxine in people with Anxiety Disorders as compared to allele del. 24723432 1184747882
SLC6A3 rs28363170 GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT/GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT disulfiram efficacy yes GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT allele referred to in the paper as the 10-repeat allele. Patients with the 10,10-repeat genotype showed a significantly greater decrease in the number of cocaine-positive urine tests and a significantly greater increase in the number of cocaine-negative urine tests than patients with either the 9,9-repeat or 9,10-repeat genotypes. This association was not seen in genotyped patients treated with placebo. Genotype GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT/GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT is associated with increased response to disulfiram in people with Cocaine-Related Disorders as compared to genotypes GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT/del + del/del. 31087723 1451106680
SLC6A3 rs28363170 del ethanol toxicity yes This variant is a VNTR; the 'del' allele represented the 9-repeat allele, while the 'GGG...' allele represents the 10-repeat allele. Subjects with the 9-repeat allele had a significantly increased odds ratio for reporting more drinking days compared to subjects carrying the 10-repeat allele. The authors note an epistatic effect, where the presence of the rs1799971 G allele in OPRM1 reduced the effect of the 9-repeat allele on the number of drinking days. There was no significant association between rs28363170 and number of drinks per drinking day or number of heavy drinking days. Allele del is associated with increased exposure to ethanol in healthy individuals as compared to allele GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT. 28376280 1450826481
SLC6A3 rs28363170 del ethanol other yes This variant is a VNTR; the 'del' allele represented the 9-repeat allele, while the 'GGG...' allele represents the 10-repeat allele. Subjects with the 9-repeat allele had higher Subjective High Assessment Scale (SHAS) scores and higher Drug Effect Questionnaire Visual Analog Scale (DEQ VAS) negative scores across all timepoints compared to subjects carrying the 10-repeat allele. The authors note an epistatic effect, where carriers of both of the 9-repeat allele and the rs1799971 G allele in OPRM1 had the highest SHAS and DEQ VAS negative scores. However, there was no significant association between this variant and BAES score, DEQ VAS positive score or POMS score. Allele del is associated with increased response to ethanol in healthy individuals as compared to allele GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT. 28376280 1450826517