Gene-drug interactions (data source: DGIdb)
Gene Name Entrez ID Drug Name Chembl ID Interaction Types Sources publications
ADRA2C 152 CABERGOLINE CHEMBL1201087 antagonist DrugBank 10641988, 18691132, 12388667
ADRA2C 152 LOXAPINE CHEMBL831 binder DrugBank
ADRA2C 152 APOMORPHINE CHEMBL53 agonist DrugBank 18691132
ADRA2C 152 METHAMPHETAMINE CHEMBL1201201 agonist TdgClinicalTrial, DrugBank 15955613, 9551769
ADRA2C 152 DRONEDARONE CHEMBL184412 DrugBank 17389667
ADRA2C 152 ILOPERIDONE CHEMBL14376 antagonist TdgClinicalTrial, DrugBank
ADRA2C 152 XYLOMETAZOLINE CHEMBL312448 agonist DrugBank 20030735
ADRA2C 152 LURASIDONE CHEMBL1237021 antagonist TdgClinicalTrial, DrugBank 23545936
ADRA2C 152 LOFEXIDINE CHEMBL17860 TdgClinicalTrial, TEND
ADRA2C 152 EPINEPHRINE BITARTRATE CHEMBL1256958 agonist ChemblInteractions
ADRA2C 152 ESMIRTAZAPINE MALEATE CHEMBL2107339 antagonist ChemblInteractions
ADRA2C 152 ERGOTAMINE TARTRATE CHEMBL2062265 agonist ChemblInteractions
ADRA2C 152 PHENTOLAMINE MESYLATE CHEMBL1200873 antagonist ChemblInteractions
ADRA2C 152 LABETALOL HYDROCHLORIDE CHEMBL1200323 antagonist ChemblInteractions
ADRA2C 152 CLONIDINE HYDROCHLORIDE CHEMBL1705 agonist ChemblInteractions
ADRA2C 152 OXYMETAZOLINE HYDROCHLORIDE CHEMBL1200791 agonist ChemblInteractions
ADRA2C 152 ERGOLOID MESYLATES CHEMBL2311030 antagonist ChemblInteractions
ADRA2C 152 NOREPINEPHRINE CHEMBL1437 agonist TdgClinicalTrial, TEND, DrugBank 17139284, 17016423, 18064417, 1654268, 17410123, 1980236, 8590979
ADRA2C 152 OLANZAPINE CHEMBL715 antagonist TdgClinicalTrial, DrugBank 17848919
ADRA2C 152 LISURIDE CHEMBL157138 DrugBank 18691132
ADRA2C 152 RISPERIDONE CHEMBL85 agonist DrugBank 15907153, 11132243
ADRA2C 152 ASENAPINE (CHEMBL3187365) CHEMBL3187365 TdgClinicalTrial
ADRA2C 152 TIZANIDINE CHEMBL1079 TdgClinicalTrial
ADRA2C 152 CLONIDINE CHEMBL134 agonist TdgClinicalTrial, ChemblInteractions
ADRA2C 152 MEPHENTERMINE SULFATE CHEMBL1200996 agonist ChemblInteractions
ADRA2C 152 NORADRENALINE CHEMBL1356607 agonist ChemblInteractions
ADRA2C 152 METHYLDOPATE HYDROCHLORIDE CHEMBL1200432 agonist ChemblInteractions
ADRA2C 152 TIZANIDINE HYDROCHLORIDE CHEMBL1200329 agonist ChemblInteractions
ADRA2C 152 GUANABENZ ACETATE CHEMBL1200560 agonist ChemblInteractions
ADRA2C 152 ARIPIPRAZOLE CHEMBL1112 antagonist DrugBank 17848919
ADRA2C 152 ROPINIROLE CHEMBL589 agonist DrugBank 18691132
ADRA2C 152 CLOZAPINE CHEMBL42 antagonist DrugBank 17848919
ADRA2C 152 FENOLDOPAM CHEMBL588 antagonist TEND, DrugBank 7670737, 17139284, 17016423
ADRA2C 152 PALIPERIDONE CHEMBL1621 agonist DrugBank 11132243
ADRA2C 152 DROXIDOPA CHEMBL2103827 agonist ChemblInteractions, DrugBank 21173850, 8590979, 18680204
ADRA2C 152 BETHANIDINE CHEMBL1201260 TdgClinicalTrial, TEND
ADRA2C 152 DEBRISOQUIN CHEMBL169901 TdgClinicalTrial, TEND
ADRA2C 152 BRIMONIDINE CHEMBL844 TEND
ADRA2C 152 FIPAMEZOLE CHEMBL1255582 TdgClinicalTrial
ADRA2C 152 DIPIVEFRIN HYDROCHLORIDE CHEMBL1200833 agonist ChemblInteractions
ADRA2C 152 EPINEPHRINE CHEMBL679 agonist ChemblInteractions
ADRA2C 152 HYDROXYAMPHETAMINE HYDROBROMIDE CHEMBL1200705 agonist ChemblInteractions
ADRA2C 152 BRIMONIDINE TARTRATE CHEMBL2062257 agonist ChemblInteractions
ADRA2C 152 APRACLONIDINE HYDROCHLORIDE CHEMBL1200379 agonist ChemblInteractions
ADRA2C 152 ALSEROXYLON CHEMBL1201454 antagonist ChemblInteractions
ADRA2C 152 TETRAHYDROZOLINE HYDROCHLORIDE CHEMBL1200413 agonist ChemblInteractions
ADRA2C 152 TOLAZOLINE HYDROCHLORIDE CHEMBL1689 antagonist ChemblInteractions
ADRA2C 152 DEXMEDETOMIDINE HYDROCHLORIDE CHEMBL2106195 agonist ChemblInteractions
ADRA2C 152 GUANFACINE HYDROCHLORIDE CHEMBL1200494 agonist ChemblInteractions
ADRA2C 152 METHYLDOPA CHEMBL459 agonist ChemblInteractions
ADRA2C 152 LEVONORDEFRIN CHEMBL677 agonist ChemblInteractions
ADRA2C 152 CARVEDILOL CHEMBL723 antagonist DrugBank 15306222
ADRA2C 152 YOHIMBINE CHEMBL15245 antagonist TdgClinicalTrial, TEND, DrugBank 16176444, 10611634, 12438517, 12591093, 11226402, 12110610
ADRA2C 152 LEVOMEPROMAZINE CHEMBL1764 antagonist DrugBank 2870716, 15701205, 6149771
ADRA2C 152 CHEMBL609728 CHEMBL609728 DrugBank
ADRA2C 152 MIANSERIN CHEMBL6437 antagonist DrugBank
ADRA2C 152 BREXPIPRAZOLE CHEMBL2105760 antagonist DrugBank 25225185
ADRA2C 152 SENREBOTASE CHEMBL3137348 TdgClinicalTrial
ADRA2C 152 FADOLMIDINE HYDROCHLORIDE CHEMBL2106710 agonist ChemblInteractions
ADRA2C 152 NAPHAZOLINE HYDROCHLORIDE CHEMBL1706 agonist ChemblInteractions
ADRA2C 152 PHENOXYBENZAMINE HYDROCHLORIDE CHEMBL1200787 antagonist ChemblInteractions
ADRA2C 152 RAUWOLFIA SERPENTINA (CHEMBL3559672) CHEMBL3559672 antagonist ChemblInteractions
ADRA2C 152 AGMATINE CHEMBL58343 agonist DrugBank 7906055
ADRA2C 152 MIRTAZAPINE CHEMBL654 antagonist, binder ChemblInteractions, DrugBank 15771415, 3419539
ADRA2C 152 TOLAZOLINE CHEMBL770 binder DrugBank 9089664

Variant-drug associations (data source: PharmGKB)
Gene Name Variant Alleles Chemical Phenotype Category Significance Notes Sentence Publications Annotation ID
ADRA2C rs11269124 GGGGAGCTTTCCCAGAGACCC/del + del/del clonidine efficacy yes Carriers of the del allele were more likely to respond to clonidine treatment than GGG.../GGG... homozygotes. Responders were defined as those with a 20% decrease in body weight and a 20% increase in urine sodium volume after 3 months of treatment. Genotypes GGGGAGCTTTCCCAGAGACCC/del + del/del are associated with increased response to clonidine in people with Liver Cirrhosis as compared to genotype GGGGAGCTTTCCCAGAGACCC/GGGGAGCTTTCCCAGAGACCC. 20833658 982044493
ADRA2C rs61767072 del metoprolol efficacy yes This SNP was studied in conjunction with rs1801253, in the ADRB1 gene. When treated with metoprolol, patients that had Arg389Arg/del-carrier genotypes had a significantly greater increase in ejection fraction as compared to patients with any other genotype (Arg389Arg/Ins/Ins, Gly389-carrier/del-carrier, or Gly389-carrier/Ins/Ins). The authors also suggest that the ADRA2C polymorphism is more strongly associated with the level of sympathetic nervous system activation than the ADRB1 polymorphism. Allele del is associated with increased response to metoprolol in people with Heart Failure as compared to allele GGGGCGGGGCCG. 17496726 981477763
ADRA2C rs61767072 GGGGCGGGGCCG/GGGGCGGGGCCG bucindolol efficacy yes This study was interested in the effect of this SNP in tandem with rs1801253. The effect of this SNP was secondary to that of rs1801253 such that variants of this SNP did not affect patient outcome unless the patient was a variant carrier for rs1801253. Patients homozygous for the Arg amino acid at rs1801253 showed significantly less occurrences of all cause mortality, cardiac transplant, or heart failure hospitalizations as compared to other patients. Patients carrying the Gly amino acid at rs1801253 but were homozygous for the wildtype allele at this SNP responded worse than those that were homozygous for wildtype allele at rs1801253, but much better than patients carrying the variant allele at both SNPs. Patients carrying the variant allele at both SNPs and were treated with bucindolol had worse outcomes than those that were given a placebo. Genotype GGGGCGGGGCCG/GGGGCGGGGCCG is associated with increased response to bucindolol in people with Heart Failure as compared to genotypes GGGGCGGGGCCG/del + del/del. 23071495 982046373